1KX5

X-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A Resolution


Experimental Data Snapshot

  • Method: X-RAY DIFFRACTION
  • Resolution: 1.94 Å
  • R-Value Free: 0.275 
  • R-Value Work: 0.208 
  • R-Value Observed: 0.209 

Starting Model: experimental
View more details

wwPDB Validation   3D Report Full Report


This is version 1.3 of the entry. See complete history


Literature

Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution

Davey, C.A.Sargent, D.F.Luger, K.Maeder, A.W.Richmond, T.J.

(2002) J Mol Biol 319: 1097-1113

  • DOI: https://doi.org/10.1016/S0022-2836(02)00386-8
  • Primary Citation of Related Structures:  
    1KX3, 1KX4, 1KX5

  • PubMed Abstract: 

    Solvent binding in the nucleosome core particle containing a 147 base pair, defined-sequence DNA is characterized from the X-ray crystal structure at 1.9 A resolution. A single-base-pair increase in DNA length over that used previously results in substantially improved clarity of the electron density and accuracy for the histone protein and DNA atomic coordinates. The reduced disorder has allowed for the first time extensive modeling of water molecules and ions. Over 3000 water molecules and 18 ions have been identified. Water molecules acting as hydrogen-bond bridges between protein and DNA are approximately equal in number to the direct hydrogen bonds between these components. Bridging water molecules have a dual role in promoting histone-DNA association not only by providing further stability to direct protein-DNA interactions, but also by enabling formation of many additional interactions between more distantly related elements. Water molecules residing in the minor groove play an important role in facilitating insertion of arginine side-chains. Water structure at the interface of the histones and DNA provides a means of accommodating intrinsic DNA conformational variation, thus limiting the sequence dependency of nucleosome positioning while enhancing mobility. Monovalent anions are bound near the N termini of histone alpha-helices that are not occluded by DNA phosphate groups. Their location in proximity to the DNA phosphodiester backbone suggests that they damp the electrostatic interaction between the histone proteins and the DNA. Divalent cations are bound at specific sites in the nucleosome core particle and contribute to histone-histone and histone-DNA interparticle interactions. These interactions may be relevant to nucleosome association in arrays.


  • Organizational Affiliation

    Institut für Molekularbiologie und Biophysik, ETH-Hönggerberg, CH-8093 Zurich, Switzerland.


Macromolecules

Find similar proteins by:  (by identity cutoff)  |  3D Structure
Entity ID: 3
MoleculeChains Sequence LengthOrganismDetailsImage
histone H3C [auth A],
G [auth E]
135Xenopus laevisMutation(s): 0 
UniProt
Find proteins for P84233 (Xenopus laevis)
Explore P84233 
Go to UniProtKB:  P84233
Entity Groups  
Sequence Clusters30% Identity50% Identity70% Identity90% Identity95% Identity100% Identity
UniProt GroupP84233
Sequence Annotations
Expand
  • Reference Sequence
Find similar proteins by:  (by identity cutoff)  |  3D Structure
Entity ID: 4
MoleculeChains Sequence LengthOrganismDetailsImage
histone H4D [auth B],
H [auth F]
102Xenopus laevisMutation(s): 0 
UniProt
Find proteins for P62799 (Xenopus laevis)
Explore P62799 
Go to UniProtKB:  P62799
Entity Groups  
Sequence Clusters30% Identity50% Identity70% Identity90% Identity95% Identity100% Identity
UniProt GroupP62799
Sequence Annotations
Expand
  • Reference Sequence
Find similar proteins by:  (by identity cutoff)  |  3D Structure
Entity ID: 5
MoleculeChains Sequence LengthOrganismDetailsImage
histone H2A.1E [auth C],
I [auth G]
128Xenopus laevisMutation(s): 1 
UniProt
Find proteins for P06897 (Xenopus laevis)
Explore P06897 
Go to UniProtKB:  P06897
Entity Groups  
Sequence Clusters30% Identity50% Identity70% Identity90% Identity95% Identity100% Identity
UniProt GroupP06897
Sequence Annotations
Expand
  • Reference Sequence
Find similar proteins by:  (by identity cutoff)  |  3D Structure
Entity ID: 6
MoleculeChains Sequence LengthOrganismDetailsImage
histone H2B.2F [auth D],
J [auth H]
125Xenopus laevisMutation(s): 1 
UniProt
Find proteins for P02281 (Xenopus laevis)
Explore P02281 
Go to UniProtKB:  P02281
Entity Groups  
Sequence Clusters30% Identity50% Identity70% Identity90% Identity95% Identity100% Identity
UniProt GroupP02281
Sequence Annotations
Expand
  • Reference Sequence
Find similar nucleic acids by:  (by identity cutoff)  |  3D Structure
Entity ID: 1
MoleculeChains LengthOrganismImage
DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3')A [auth I]147Homo sapiens
Sequence Annotations
Expand
  • Reference Sequence
Find similar nucleic acids by:  (by identity cutoff)  |  3D Structure
Entity ID: 2
MoleculeChains LengthOrganismImage
DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3')B [auth J]147Homo sapiens
Sequence Annotations
Expand
  • Reference Sequence
Small Molecules
Ligands 2 Unique
IDChains Name / Formula / InChI Key2D Diagram3D Interactions
MN
Query on MN

Download Ideal Coordinates CCD File 
K [auth I]
L [auth I]
M [auth I]
N [auth I]
O [auth I]
K [auth I],
L [auth I],
M [auth I],
N [auth I],
O [auth I],
P [auth I],
Q [auth I],
R [auth J],
S [auth J],
T [auth J],
U [auth J],
V [auth J],
W [auth J],
Z [auth E]
MANGANESE (II) ION
Mn
WAEMQWOKJMHJLA-UHFFFAOYSA-N
CL
Query on CL

Download Ideal Coordinates CCD File 
AA [auth E],
BA [auth H],
X [auth A],
Y [auth D]
CHLORIDE ION
Cl
VEXZGXHMUGYJMC-UHFFFAOYSA-M
Experimental Data & Validation

Experimental Data

  • Method: X-RAY DIFFRACTION
  • Resolution: 1.94 Å
  • R-Value Free: 0.275 
  • R-Value Work: 0.208 
  • R-Value Observed: 0.209 
  • Space Group: P 21 21 21
Unit Cell:
Length ( Å )Angle ( ˚ )
a = 105.95α = 90
b = 181.17β = 90
c = 109.49γ = 90
Software Package:
Software NamePurpose
DENZOdata reduction
SCALEPACKdata scaling
CNSrefinement
CNSphasing

Structure Validation

View Full Validation Report



Entry History 

Deposition Data

Revision History  (Full details and data files)

  • Version 1.0: 2002-12-25
    Type: Initial release
  • Version 1.1: 2008-04-27
    Changes: Version format compliance
  • Version 1.2: 2011-07-13
    Changes: Version format compliance
  • Version 1.3: 2023-08-16
    Changes: Data collection, Database references, Derived calculations, Refinement description