Three-dimensional structure of s.aureus methicillin-resistance regulating transcriptional repressor meci in complex with 25-bp ds-DNA
External Resource: Annotation
- Domain Annotation: SCOP/SCOPe Classification
- Domain Annotation: SCOP2 Classification
- Domain Annotation: ECOD Classification
- Domain Annotation: CATH
- AMR Gene: CARD Annotation
- AMR Gene Family: CARD Annotation
- Protein Family Annotation
- Gene Ontology: Gene Product Annotation
- InterPro: Protein Family Classification
Domain Annotation: SCOP/SCOPe Classification SCOP-e Database Homepage
Chains | Domain Info | Class | Fold | Superfamily | Family | Domain | Species | Provenance Source (Version) |
---|---|---|---|---|---|---|---|---|
C [auth A] | d1saxa_ | All alpha proteins | DNA/RNA-binding 3-helical bundle | 'Winged helix' DNA-binding domain | Penicillinase repressor | Methicillin resistance regulatory protein MecI | (Staphylococcus aureus subsp. aureus N315 ) [TaxId: 158879 ], | SCOPe (2.08) |
D [auth B] | d1saxb_ | All alpha proteins | DNA/RNA-binding 3-helical bundle | 'Winged helix' DNA-binding domain | Penicillinase repressor | Methicillin resistance regulatory protein MecI | (Staphylococcus aureus subsp. aureus N315 ) [TaxId: 158879 ], | SCOPe (2.08) |
Domain Annotation: SCOP2 Classification SCOP2 Database Homepage
Chains | Type | Family Name | Domain Identifier | Family Identifier | Provenance Source (Version) |
---|---|---|---|---|---|
C [auth A] | SCOP2B Superfamily | Winged helix DNA-binding domain | 8002966 | 3000034 | SCOP2B (2022-06-29) |
C [auth A] | SCOP2B Superfamily | Penicillinase repressor dimerisation region-like | 8056265 | 3002339 | SCOP2B (2022-06-29) |
D [auth B] | SCOP2B Superfamily | Penicillinase repressor dimerisation region-like | 8056265 | 3002339 | SCOP2B (2022-06-29) |
D [auth B] | SCOP2B Superfamily | Winged helix DNA-binding domain | 8002966 | 3000034 | SCOP2B (2022-06-29) |
Domain Annotation: ECOD Classification ECOD Database Homepage
Chains | Family Name | Domain Identifier | Architecture | Possible Homology | Homology | Topology | Family | Provenance Source (Version) |
---|---|---|---|---|---|---|---|---|
C [auth A] | Penicillinase_R | e1saxA1 | A: alpha arrays | X: HTH | H: HTH | T: winged | F: Penicillinase_R | ECOD (1.6) |
D [auth B] | Penicillinase_R | e1saxB1 | A: alpha arrays | X: HTH | H: HTH | T: winged | F: Penicillinase_R | ECOD (1.6) |
Domain Annotation: CATH CATH Database Homepage
Chain | Domain | Class | Architecture | Topology | Homology | Provenance Source (Version) |
---|---|---|---|---|---|---|
C [auth A] | 1.10.10.10 | Mainly Alpha | Orthogonal Bundle | Arc Repressor Mutant, subunit A | Winged helix-like DNA-binding domain superfamily/Winged helix DNA-binding domain | CATH (4.3.0) |
C [auth A] | 1.10.4040.10 | Mainly Alpha | Orthogonal Bundle | Penicillinase repressor fold | Penicillinase repressor domain | CATH (4.3.0) |
D [auth B] | 1.10.10.10 | Mainly Alpha | Orthogonal Bundle | Arc Repressor Mutant, subunit A | Winged helix-like DNA-binding domain superfamily/Winged helix DNA-binding domain | CATH (4.3.0) |
D [auth B] | 1.10.4040.10 | Mainly Alpha | Orthogonal Bundle | Penicillinase repressor fold | Penicillinase repressor domain | CATH (4.3.0) |
AMR Gene: CARD Annotation CARD Database Homepage
Chains | Accession | Short Name | Description | Provenance Source (Version) |
---|---|---|---|---|
C [auth A], D [auth B] | ARO:3000124 | mecI | mecI acts as a repressor of transcription of the mecA/mecR1/mecI operon. | CARD (4.0.0) |
AMR Gene Family: CARD Annotation CARD Database Homepage
Chains | Accession | Gene Family | Drug Class | Resistance Machanism | Provenance Source (Version) |
---|---|---|---|---|---|
C [auth A], D [auth B] | ARO:3001208 | methicillin resistant PBP2 | penicillin beta-lactam | antibiotic target replacement | CARD (4.0.0) |
Protein Family Annotation Pfam Database Homepage
Chains | Accession | Name | Description | Comments | Source |
---|---|---|---|---|---|
C [auth A], D [auth B] | PF03965 | Penicillinase repressor (Penicillinase_R) | Penicillinase repressor | - | Family |
Gene Ontology: Gene Product Annotation Gene Ontology Database Homepage
Chains | Polymer | Molecular Function | Biological Process | Cellular Component |
---|---|---|---|---|
C [auth A], D [auth B] | Methicillin resistance regulatory protein mecI |
| ||
A [auth C] | 5'-d(GCTCCGATATTACAGTTGTAATTTT)-3' | - | - | - |
B [auth D] | 5'-d(CAAAATTACAACTGTAATATCGGAG)-3' | - | - | - |
InterPro: Protein Family Classification InterPro Database Homepage
Chains | Accession | Name | Type |
---|---|---|---|
C [auth A], D [auth B] | IPR005650 | BlaI transcriptional regulatory family | Family |
C [auth A], D [auth B] | IPR036388 | Winged helix-like DNA-binding domain superfamily | Homologous Superfamily |
C [auth A], D [auth B] | IPR036390 | Winged helix DNA-binding domain superfamily | Homologous Superfamily |