1SAX | pdb_00001sax

Three-dimensional structure of s.aureus methicillin-resistance regulating transcriptional repressor meci in complex with 25-bp ds-DNA

CHAIN

A [auth C]

5'-d(gctccgatattacagttgtaatttt)-3' -

Explore Sequence Annotations in 3D

LOADING

RCSB PDB Core Operations are funded by the U.S. National Science Foundation (DBI-2321666), the US Department of Energy (DE-SC0019749), and the National Cancer Institute, National Institute of Allergy and Infectious Diseases, and National Institute of General Medical Sciences of the National Institutes of Health under grant R01GM157729.