1SAX | pdb_00001sax

Three-dimensional structure of s.aureus methicillin-resistance regulating transcriptional repressor meci in complex with 25-bp ds-DNA

External Resource: Annotation

Domain Annotation: SCOP/SCOPe Classification
Domain Annotation: SCOP2 Classification
Domain Annotation: ECOD Classification
Domain Annotation: CATH
AMR Gene: CARD Annotation
AMR Gene Family: CARD Annotation
Protein Family Annotation
Gene Ontology: Gene Product Annotation
InterPro: Protein Family Classification

Domain Annotation: SCOP/SCOPe Classification SCOP-e Database Homepage

Chains	Domain Info	Class	Fold	Superfamily	Family	Domain	Species	Provenance Source (Version)
C [auth A]	d1saxa_	All alpha proteins	DNA/RNA-binding 3-helical bundle	'Winged helix' DNA-binding domain	Penicillinase repressor	Methicillin resistance regulatory protein MecI	(Staphylococcus aureus subsp. aureus N315 ) [TaxId: 158879 ],	SCOPe (2.08)
D [auth B]	d1saxb_	All alpha proteins	DNA/RNA-binding 3-helical bundle	'Winged helix' DNA-binding domain	Penicillinase repressor	Methicillin resistance regulatory protein MecI	(Staphylococcus aureus subsp. aureus N315 ) [TaxId: 158879 ],	SCOPe (2.08)

Domain Annotation: SCOP2 Classification SCOP2 Database Homepage

Chains	Type	Family Name	Domain Identifier	Family Identifier	Provenance Source (Version)
C [auth A]	SCOP2B Superfamily	Winged helix DNA-binding domain	8002966	3000034	SCOP2B (2022-06-29)
C [auth A]	SCOP2B Superfamily	Penicillinase repressor dimerisation region-like	8056265	3002339	SCOP2B (2022-06-29)
D [auth B]	SCOP2B Superfamily	Penicillinase repressor dimerisation region-like	8056265	3002339	SCOP2B (2022-06-29)
D [auth B]	SCOP2B Superfamily	Winged helix DNA-binding domain	8002966	3000034	SCOP2B (2022-06-29)

Domain Annotation: ECOD Classification ECOD Database Homepage

Chains	Family Name	Domain Identifier	Architecture	Possible Homology	Homology	Topology	Family	Provenance Source (Version)
C [auth A]	Penicillinase_R	e1saxA1	A: alpha arrays	X: HTH	H: HTH	T: winged	F: Penicillinase_R	ECOD (1.6)
D [auth B]	Penicillinase_R	e1saxB1	A: alpha arrays	X: HTH	H: HTH	T: winged	F: Penicillinase_R	ECOD (1.6)

Domain Annotation: CATH CATH Database Homepage

Chain	Domain	Class	Architecture	Topology	Homology	Provenance Source (Version)
C [auth A]	1.10.10.10	Mainly Alpha	Orthogonal Bundle	Arc Repressor Mutant, subunit A	Winged helix-like DNA-binding domain superfamily/Winged helix DNA-binding domain	CATH (4.3.0)
C [auth A]	1.10.4040.10	Mainly Alpha	Orthogonal Bundle	Penicillinase repressor fold	Penicillinase repressor domain	CATH (4.3.0)
D [auth B]	1.10.10.10	Mainly Alpha	Orthogonal Bundle	Arc Repressor Mutant, subunit A	Winged helix-like DNA-binding domain superfamily/Winged helix DNA-binding domain	CATH (4.3.0)
D [auth B]	1.10.4040.10	Mainly Alpha	Orthogonal Bundle	Penicillinase repressor fold	Penicillinase repressor domain	CATH (4.3.0)

AMR Gene: CARD Annotation CARD Database Homepage

Chains	Accession	Short Name	Description	Provenance Source (Version)
C [auth A], D [auth B]	ARO:3000124	mecI	mecI acts as a repressor of transcription of the mecA/mecR1/mecI operon.	CARD (4.0.0)

AMR Gene Family: CARD Annotation CARD Database Homepage

Chains	Accession	Gene Family	Drug Class	Resistance Machanism	Provenance Source (Version)
C [auth A], D [auth B]	ARO:3001208	methicillin resistant PBP2	penicillin beta-lactam	antibiotic target replacement	CARD (4.0.0)

Protein Family Annotation Pfam Database Homepage

Chains	Accession	Name	Description	Comments	Source
C [auth A], D [auth B]	PF03965	Penicillinase repressor (Penicillinase_R)	Penicillinase repressor	-	Family

Gene Ontology: Gene Product Annotation Gene Ontology Database Homepage

Chains	Polymer	Molecular Function	Biological Process	Cellular Component
A [auth C]	5'-d(GCTCCGATATTACAGTTGTAATTTT)-3'	-	-	-
B [auth D]	5'-d(CAAAATTACAACTGTAATATCGGAG)-3'	-	-	-
C [auth A], D [auth B]	Methicillin resistance regulatory protein mecI	DNA binding binding nucleic acid binding	regulation of cellular process negative regulation of biological process RNA metabolic process regulation of primary metabolic process negative regulation of RNA biosynthetic process RNA biosynthetic process nucleobase-containing compound metabolic process DNA-templated transcription nucleic acid biosynthetic process regulation of RNA metabolic process negative regulation of cellular process negative regulation of nucleobase-containing compound metabolic process regulation of nucleobase-containing compound metabolic process regulation of RNA biosynthetic process regulation of cellular process negative regulation of biological process RNA metabolic process regulation of primary metabolic process negative regulation of RNA biosynthetic process RNA biosynthetic process nucleobase-containing compound metabolic process DNA-templated transcription nucleic acid biosynthetic process regulation of RNA metabolic process negative regulation of cellular process negative regulation of nucleobase-containing compound metabolic process regulation of nucleobase-containing compound metabolic process regulation of RNA biosynthetic process negative regulation of macromolecule metabolic process regulation of biosynthetic process negative regulation of DNA-templated transcription regulation of biological process negative regulation of metabolic process biological regulation primary metabolic process regulation of macromolecule metabolic process nucleobase-containing compound biosynthetic process gene expression macromolecule biosynthetic process nucleic acid metabolic process regulation of gene expression biosynthetic process negative regulation of biosynthetic process negative regulation of macromolecule biosynthetic process metabolic process cellular process regulation of macromolecule biosynthetic process macromolecule metabolic process regulation of DNA-templated transcription regulation of metabolic process negative regulation of RNA metabolic process response to stimulus response to chemical response to antibiotic	cellular anatomical structure intracellular anatomical structure cytoplasm

InterPro: Protein Family Classification InterPro Database Homepage

Chains	Accession	Name	Type
C [auth A], D [auth B]	IPR005650	BlaI transcriptional regulatory family	Family
C [auth A], D [auth B]	IPR036388	Winged helix-like DNA-binding domain superfamily	Homologous Superfamily
C [auth A], D [auth B]	IPR036390	Winged helix DNA-binding domain superfamily	Homologous Superfamily

RCSB PDB Core Operations are funded by the U.S. National Science Foundation (DBI-2321666), the US Department of Energy (DE-SC0019749), and the National Cancer Institute, National Institute of Allergy and Infectious Diseases, and National Institute of General Medical Sciences of the National Institutes of Health under grant R01GM157729.